SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000198765@66_37.A10.115537601 ()

MNR A10 at position 115537601 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
GCACTTAAAA AATTAAACAT GTTATGATTT TTAAATTTTA TTTTGTACTC AGGCCCCTTC ATCTCTAACA ACCCCTGGAT CTACACTGAA GTTTGGAGCT ATAAGAAAAA TGCGGGAGGA CCGTTGGGCT GTAATTGCTA AAATGGATAG AAAAAAAAAA CTAAAAGAAG CTGAAAAGTT ATTTGTTTAA TTTCAGAGAA TCAGTGTAGT TAAGGAGCCT AATAACGTGA AACTTATAGT TAATATTTTG TTCTTATTTG CCAGAGCCAA ATTTTATCTG GAAGTTGAGA CTTAAAAAAT ACTTGCATGA
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 310 115537451

sequence GCACTTAAAAAATTAAACATGTTATGATTTTTAAATTTTATTTTGTACTCAGGCCCCTTCATCTCTAACAACCCCTGGATCTACACTGAAGTTTGGAGCTATAAGAAAAATGCGGGAGGACCGTTGGGCTGTAATTGCTAAAATGGATAGAAAAAAAAAACTAAAAGAAGCTGAAAAGTTATTTGTTTAATTTCAGAGAATCAGTGTAGTTAAGGAGCCTAATAACGTGAAACTTATAGTTAATATTTTGTTCTTATTTGCCAGAGCCAAATTTTATCTGGAAGTTGAGACTTAAAAAATACTTGCATGA, GCACTTAAAAAATTAAACATGTTATGATTTTTAAATTTTATTTTGTACTCAGGCCCCTTCATCTCTAACAACCCCTGGATCTACACTGAAGTTTGGAGCTATAAGAAAAATGCGGGAGGACCGTTGGGCTGTAATTGCTAAAATGGATAGAAAAAAAAAACTAAAAGAAGCTGAAAAGTTATTTGTTTAATTTCAGAGAATCAGTGTAGTTAAGGAGCCTAATAACGTGAAACTTATAGTTAATATTTTGTTCTTATTTGCCAGAGCCAAATTTTATCTGGAAGTTGAGACTTAAAAAATACTTGCATGA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 10 seqb mnr_start 151 seqb mnr_end 160.

$sequence: GCACTTAAAAAATTAAACATGTTATGATTTTTAAATTTTATTTTGTACTCAGGCCCCTTCATCTCTAACAACCCCTGGATCTACACTGAAGTTTGGAGCTATAAGAAAAATGCGGGAGGACCGTTGGGCTGTAATTGCTAAAATGGATAGAAAAAAAAAACTAAAAGAAGCTGAAAAGTTATTTGTTTAATTTCAGAGAATCAGTGTAGTTAAGGAGCCTAATAACGTGAAACTTATAGTTAATATTTTGTTCTTATTTGCCAGAGCCAAATTTTATCTGGAAGTTGAGACTTAAAAAATACTTGCATGA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 10 seqb mnr_start 151 seqb mnr_end 160 seqa tract_start 1 seqa tract_end 6 seqb tract_start 7 seqb tract_end 12 seqa tract_start 1 seqa tract_end 5 seqb tract_start 28 seqb tract_end 32 seqa tract_start 1 seqa tract_end 4 seqb tract_start 36 seqb tract_end 39 seqa tract_start 1 seqa tract_end 4 seqb tract_start 41 seqb tract_end 44 seqa tract_start 1 seqa tract_end 4 seqb tract_start 54 seqb tract_end 57 seqa tract_start 1 seqa tract_end 4 seqb tract_start 72 seqb tract_end 75 seqa tract_start 1 seqa tract_end 5 seqb tract_start 106 seqb tract_end 110 seqa tract_start 1 seqa tract_end 4 seqb tract_start 140 seqb tract_end 143 seqa tract_start 1 seqa tract_end 10 seqb tract_start 151 seqb tract_end 160 seqa tract_start 1 seqa tract_end 4 seqb tract_start 163 seqb tract_end 166 seqa tract_start 1 seqa tract_end 4 seqb tract_start 174 seqb tract_end 177 seqa tract_start 1 seqa tract_end 4 seqb tract_start 246 seqb tract_end 249 seqa tract_start 1 seqa tract_end 4 seqb tract_start 272 seqb tract_end 275 seqa tract_start 1 seqa tract_end 6 seqb tract_start 294 seqb tract_end 299.

highlight_homology: seqb mnr_start 151 seqb mnr_end 160 seqb tract_start 7 seqb tract_end 12 seqb tract_start 28 seqb tract_end 32 seqb tract_start 36 seqb tract_end 39 seqb tract_start 41 seqb tract_end 44 seqb tract_start 54 seqb tract_end 57 seqb tract_start 72 seqb tract_end 75 seqb tract_start 106 seqb tract_end 110 seqb tract_start 140 seqb tract_end 143 seqb tract_start 151 seqb tract_end 160 seqb tract_start 163 seqb tract_end 166 seqb tract_start 174 seqb tract_end 177 seqb tract_start 246 seqb tract_end 249 seqb tract_start 272 seqb tract_end 275 seqb tract_start 294 seqb tract_end 299.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 115537601 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 115537601 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 115537601 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 115537601;