SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000163568@66_37.A4.159038376 ()

MNR A4 at position 159038376 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
ATGCTTTTCA TGCTGTGGCC TTGCTTCCCT TATTTGCATG CTGTGAGATA AAGAACAGAG AACAATATGG GAAGTGACAG TGACAGTGAT GCTCTTACAA GGACAAAGAC CACTCCACTC TCCTTATCCT ACCTTAACAT GAGGAGAGAC TTTTGGTGCA GCACGTTGCT TTGCGACATC ATTTCTGATG GCTGCAGATG CAGCAGGACT CATTTCAGCT TGACTTAGTG GCTTTGGTTT TGTTACCGAT TTGTATTGCT TATCAACTGA TTAAAAAATG AAAGACATGG CCAATAAGCA TATA
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 304 159038226

sequence ATGCTTTTCATGCTGTGGCCTTGCTTCCCTTATTTGCATGCTGTGAGATAAAGAACAGAGAACAATATGGGAAGTGACAGTGACAGTGATGCTCTTACAAGGACAAAGACCACTCCACTCTCCTTATCCTACCTTAACATGAGGAGAGACTTTTGGTGCAGCACGTTGCTTTGCGACATCATTTCTGATGGCTGCAGATGCAGCAGGACTCATTTCAGCTTGACTTAGTGGCTTTGGTTTTGTTACCGATTTGTATTGCTTATCAACTGATTAAAAAATGAAAGACATGGCCAATAAGCATATA, ATGCTTTTCATGCTGTGGCCTTGCTTCCCTTATTTGCATGCTGTGAGATAAAGAACAGAGAACAATATGGGAAGTGACAGTGACAGTGATGCTCTTACAAGGACAAAGACCACTCCACTCTCCTTATCCTACCTTAACATGAGGAGAGACTTTTGGTGCAGCACGTTGCTTTGCGACATCATTTCTGATGGCTGCAGATGCAGCAGGACTCATTTCAGCTTGACTTAGTGGCTTTGGTTTTGTTACCGATTTGTATTGCTTATCAACTGATTAAAAAATGAAAGACATGGCCAATAAGCATATA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154.

$sequence: ATGCTTTTCATGCTGTGGCCTTGCTTCCCTTATTTGCATGCTGTGAGATAAAGAACAGAGAACAATATGGGAAGTGACAGTGACAGTGATGCTCTTACAAGGACAAAGACCACTCCACTCTCCTTATCCTACCTTAACATGAGGAGAGACTTTTGGTGCAGCACGTTGCTTTGCGACATCATTTCTGATGGCTGCAGATGCAGCAGGACTCATTTCAGCTTGACTTAGTGGCTTTGGTTTTGTTACCGATTTGTATTGCTTATCAACTGATTAAAAAATGAAAGACATGGCCAATAAGCATATA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 5 seqb tract_end 8 seqa tract_start 1 seqa tract_end 4 seqb tract_start 151 seqb tract_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 238 seqb tract_end 241 seqa tract_start 1 seqa tract_end 6 seqb tract_start 273 seqb tract_end 278.

highlight_homology: seqb mnr_start 151 seqb mnr_end 154 seqb tract_start 5 seqb tract_end 8 seqb tract_start 151 seqb tract_end 154 seqb tract_start 238 seqb tract_end 241 seqb tract_start 273 seqb tract_end 278.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 159038376 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 159038376 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 159038376 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 159038376;