SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000163568@66_37.A4.159035943 ()

MNR A4 at position 159035943 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
GTTCAGCGGG ACATTAACCT TTTGGTCAGA TTCAGCATCT AACACACGTG AGGCGCTATT TACCTCTAAG AAACCACTGT GCCGATAATA TCTTGCTATT ATAATTATTC TCTTTGGAAT GAATTTATCT TTCAGCAGTG TATTAAAAAC TTTTACAAAG AAGAATTCCT TTTCTGTAGC CACTGTAGCA TGAAACATCT CCTGCTTGCC TTCTTGGGTC TCAAACGTGA AGGGCTTCTT TGCTTTCAGT ACCATAACTG GCAAACAGCG CTTCTGAAAC CCTTCTCTGA TAGATTCCTG CTGG
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 304 159035793

sequence GTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTATTATAATTATTCTCTTTGGAATGAATTTATCTTTCAGCAGTGTATTAAAAACTTTTACAAAGAAGAATTCCTTTTCTGTAGCCACTGTAGCATGAAACATCTCCTGCTTGCCTTCTTGGGTCTCAAACGTGAAGGGCTTCTTTGCTTTCAGTACCATAACTGGCAAACAGCGCTTCTGAAACCCTTCTCTGATAGATTCCTGCTGG, GTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTATTATAATTATTCTCTTTGGAATGAATTTATCTTTCAGCAGTGTATTAAAAACTTTTACAAAGAAGAATTCCTTTTCTGTAGCCACTGTAGCATGAAACATCTCCTGCTTGCCTTCTTGGGTCTCAAACGTGAAGGGCTTCTTTGCTTTCAGTACCATAACTGGCAAACAGCGCTTCTGAAACCCTTCTCTGATAGATTCCTGCTGG.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154.

$sequence: GTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTATTATAATTATTCTCTTTGGAATGAATTTATCTTTCAGCAGTGTATTAAAAACTTTTACAAAGAAGAATTCCTTTTCTGTAGCCACTGTAGCATGAAACATCTCCTGCTTGCCTTCTTGGGTCTCAAACGTGAAGGGCTTCTTTGCTTTCAGTACCATAACTGGCAAACAGCGCTTCTGAAACCCTTCTCTGATAGATTCCTGCTGG.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 20 seqb tract_end 23 seqa tract_start 1 seqa tract_end 5 seqb tract_start 145 seqb tract_end 149 seqa tract_start 1 seqa tract_end 4 seqb tract_start 151 seqb tract_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 170 seqb tract_end 173.

highlight_homology: seqb mnr_start 151 seqb mnr_end 154 seqb tract_start 20 seqb tract_end 23 seqb tract_start 145 seqb tract_end 149 seqb tract_start 151 seqb tract_end 154 seqb tract_start 170 seqb tract_end 173.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 159035943 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 159035943 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 159035943 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 159035943;