SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000163568@66_37.C4.159035738 ()

MNR C4 at position 159035738 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
TTTATTTTGT CTATATAGAA AGACATTAAA ACCATTTCCA AAGTTTCTTT AAGATCAGAT GGGAAATACG TTATTCTTAC TAATCAATAT GAAATTAGAT ATGAAAACTT ACCTTCTGGA CTACAAACAA ACCATTCACA ATTGTTCCAA GGGGCTGAGT TTGAAGCGTG TTGATCTTCG GGGTTTCACC AGCTTTTCTG ATAATGTTCA GCGGGACATT AACCTTTTGG TCAGATTCAG CATCTAACAC ACGTGAGGCG CTATTTACCT CTAAGAAACC ACTGTGCCGA TAATATCTTG CTAT
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 304 159035588

sequence TTTATTTTGTCTATATAGAAAGACATTAAAACCATTTCCAAAGTTTCTTTAAGATCAGATGGGAAATACGTTATTCTTACTAATCAATATGAAATTAGATATGAAAACTTACCTTCTGGACTACAAACAAACCATTCACAATTGTTCCAAGGGGCTGAGTTTGAAGCGTGTTGATCTTCGGGGTTTCACCAGCTTTTCTGATAATGTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTAT, TTTATTTTGTCTATATAGAAAGACATTAAAACCATTTCCAAAGTTTCTTTAAGATCAGATGGGAAATACGTTATTCTTACTAATCAATATGAAATTAGATATGAAAACTTACCTTCTGGACTACAAACAAACCATTCACAATTGTTCCAAGGGGCTGAGTTTGAAGCGTGTTGATCTTCGGGGTTTCACCAGCTTTTCTGATAATGTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTAT.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154.

$sequence: TTTATTTTGTCTATATAGAAAGACATTAAAACCATTTCCAAAGTTTCTTTAAGATCAGATGGGAAATACGTTATTCTTACTAATCAATATGAAATTAGATATGAAAACTTACCTTCTGGACTACAAACAAACCATTCACAATTGTTCCAAGGGGCTGAGTTTGAAGCGTGTTGATCTTCGGGGTTTCACCAGCTTTTCTGATAATGTTCAGCGGGACATTAACCTTTTGGTCAGATTCAGCATCTAACACACGTGAGGCGCTATTTACCTCTAAGAAACCACTGTGCCGATAATATCTTGCTAT.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 5 seqb tract_end 8 seqa tract_start 1 seqa tract_end 4 seqb tract_start 28 seqb tract_end 31 seqa tract_start 1 seqa tract_end 4 seqb tract_start 104 seqb tract_end 107 seqa tract_start 1 seqa tract_end 4 seqb tract_start 151 seqb tract_end 154 seqa tract_start 1 seqa tract_end 4 seqb tract_start 180 seqb tract_end 183 seqa tract_start 1 seqa tract_end 4 seqb tract_start 194 seqb tract_end 197 seqa tract_start 1 seqa tract_end 4 seqb tract_start 225 seqb tract_end 228.

highlight_homology: seqb mnr_start 151 seqb mnr_end 154 seqb tract_start 5 seqb tract_end 8 seqb tract_start 28 seqb tract_end 31 seqb tract_start 104 seqb tract_end 107 seqb tract_start 151 seqb tract_end 154 seqb tract_start 180 seqb tract_end 183 seqb tract_start 194 seqb tract_end 197 seqb tract_start 225 seqb tract_end 228.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 159035738 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 159035738 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 159035738 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 159035738;