SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000163568@66_37.A5.159033445 ()

MNR A5 at position 159033445 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
CCAGATGTCA GCTGTAGTTT TTCTCCATTT TTTGACAGTG TGAAGAATGT AAGTCGAACC TTATCTCCTT CCTTACATTT CATTGTGTCC TCGTTTCTAA CCCCCAGTAC TTCCATTTTC CCAGTGTTGT CACTTAGGTC AAATAATATG TTTTTCTTCT TTTCTGTTAC CTATAAAAGA AAATCAACAC CCAGCCTCTG ATAATCGGAT TAATGAATGC CGCATCAGTC ACACATCAGA CATGCCAGAA GAAGGCTCTA AAAAGAAATC AGTTGATTCT TGAACAACAC AGATTTTACC TGTGC
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 305 159033295

sequence CCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAATCAGTTGATTCTTGAACAACACAGATTTTACCTGTGC, CCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAATCAGTTGATTCTTGAACAACACAGATTTTACCTGTGC.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 5 seqb mnr_start 151 seqb mnr_end 155.

$sequence: CCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAATCAGTTGATTCTTGAACAACACAGATTTTACCTGTGC.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 5 seqb mnr_start 151 seqb mnr_end 155 seqa tract_start 1 seqa tract_end 5 seqb tract_start 18 seqb tract_end 22 seqa tract_start 1 seqa tract_end 6 seqb tract_start 28 seqb tract_end 33 seqa tract_start 1 seqa tract_end 5 seqb tract_start 101 seqb tract_end 105 seqa tract_start 1 seqa tract_end 4 seqb tract_start 116 seqb tract_end 119 seqa tract_start 1 seqa tract_end 5 seqb tract_start 151 seqb tract_end 155 seqa tract_start 1 seqa tract_end 4 seqb tract_start 160 seqb tract_end 163 seqa tract_start 1 seqa tract_end 4 seqb tract_start 175 seqb tract_end 178 seqa tract_start 1 seqa tract_end 4 seqb tract_start 180 seqb tract_end 183 seqa tract_start 1 seqa tract_end 5 seqb tract_start 260 seqb tract_end 264 seqa tract_start 1 seqa tract_end 4 seqb tract_start 294 seqb tract_end 297.

highlight_homology: seqb mnr_start 151 seqb mnr_end 155 seqb tract_start 18 seqb tract_end 22 seqb tract_start 28 seqb tract_end 33 seqb tract_start 101 seqb tract_end 105 seqb tract_start 116 seqb tract_end 119 seqb tract_start 151 seqb tract_end 155 seqb tract_start 160 seqb tract_end 163 seqb tract_start 175 seqb tract_end 178 seqb tract_start 180 seqb tract_end 183 seqb tract_start 260 seqb tract_end 264 seqb tract_start 294 seqb tract_end 297.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 159033445 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 159033445 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 159033445 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 159033445;