SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000163568@66_37.A4.159033410 ()

MNR A4 at position 159033410 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
TCCATGCAGT TCCCACCTTT ATGGTGCTAT GAACTCCAGA TGTCAGCTGT AGTTTTTCTC CATTTTTTGA CAGTGTGAAG AATGTAAGTC GAACCTTATC TCCTTCCTTA CATTTCATTG TGTCCTCGTT TCTAACCCCC AGTACTTCCA TTTTCCCAGT GTTGTCACTT AGGTCAAATA ATATGTTTTT CTTCTTTTCT GTTACCTATA AAAGAAAATC AACACCCAGC CTCTGATAAT CGGATTAATG AATGCCGCAT CAGTCACACA TCAGACATGC CAGAAGAAGG CTCTAAAAAG AAAT
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 304 159033260

sequence TCCATGCAGTTCCCACCTTTATGGTGCTATGAACTCCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAAT, TCCATGCAGTTCCCACCTTTATGGTGCTATGAACTCCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAAT.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154.

$sequence: TCCATGCAGTTCCCACCTTTATGGTGCTATGAACTCCAGATGTCAGCTGTAGTTTTTCTCCATTTTTTGACAGTGTGAAGAATGTAAGTCGAACCTTATCTCCTTCCTTACATTTCATTGTGTCCTCGTTTCTAACCCCCAGTACTTCCATTTTCCCAGTGTTGTCACTTAGGTCAAATAATATGTTTTTCTTCTTTTCTGTTACCTATAAAAGAAAATCAACACCCAGCCTCTGATAATCGGATTAATGAATGCCGCATCAGTCACACATCAGACATGCCAGAAGAAGGCTCTAAAAAGAAAT.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 4 seqb mnr_start 151 seqb mnr_end 154 seqa tract_start 1 seqa tract_end 5 seqb tract_start 53 seqb tract_end 57 seqa tract_start 1 seqa tract_end 6 seqb tract_start 63 seqb tract_end 68 seqa tract_start 1 seqa tract_end 5 seqb tract_start 136 seqb tract_end 140 seqa tract_start 1 seqa tract_end 4 seqb tract_start 151 seqb tract_end 154 seqa tract_start 1 seqa tract_end 5 seqb tract_start 186 seqb tract_end 190 seqa tract_start 1 seqa tract_end 4 seqb tract_start 195 seqb tract_end 198 seqa tract_start 1 seqa tract_end 4 seqb tract_start 210 seqb tract_end 213 seqa tract_start 1 seqa tract_end 4 seqb tract_start 215 seqb tract_end 218 seqa tract_start 1 seqa tract_end 5 seqb tract_start 295 seqb tract_end 299.

highlight_homology: seqb mnr_start 151 seqb mnr_end 154 seqb tract_start 53 seqb tract_end 57 seqb tract_start 63 seqb tract_end 68 seqb tract_start 136 seqb tract_end 140 seqb tract_start 151 seqb tract_end 154 seqb tract_start 186 seqb tract_end 190 seqb tract_start 195 seqb tract_end 198 seqb tract_start 210 seqb tract_end 213 seqb tract_start 215 seqb tract_end 218 seqb tract_start 295 seqb tract_end 299.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 159033410 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 159033410 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 159033410 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 159033410;