SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000113318@66_37.A8.79970915 ()

MNR A8 at position 79970915 on chromosome 5.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
ATTTAGCATA TAATTATTTT TCTTTAATTA TTATTAAATG TGAATCCCCT AATCAAGCTG GATGATGCTG TAAATGTTGA TGAGATAATG ACTGATACTT CTACCAGCTA TCTTCTGTGC ATCTCTGAAA ATAAGGAAAA TGTTAGGGAC AAAAAAAAGG GCAACATTTT TATTGGCATT GTGGTAAGTA CTTTGCAGGT GAGGAACAAA TGTTAGATGT TCATGGTATC TCTAAATATG ATCTATCATG TATGGTTTAT AATAAGGATA TCTGATGAAG TGTACCTTCA GATAATTATA CAAGAAAA
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/5.fa 308 79970765

sequence ATTTAGCATATAATTATTTTTCTTTAATTATTATTAAATGTGAATCCCCTAATCAAGCTGGATGATGCTGTAAATGTTGATGAGATAATGACTGATACTTCTACCAGCTATCTTCTGTGCATCTCTGAAAATAAGGAAAATGTTAGGGACAAAAAAAAGGGCAACATTTTTATTGGCATTGTGGTAAGTACTTTGCAGGTGAGGAACAAATGTTAGATGTTCATGGTATCTCTAAATATGATCTATCATGTATGGTTTATAATAAGGATATCTGATGAAGTGTACCTTCAGATAATTATACAAGAAAA, ATTTAGCATATAATTATTTTTCTTTAATTATTATTAAATGTGAATCCCCTAATCAAGCTGGATGATGCTGTAAATGTTGATGAGATAATGACTGATACTTCTACCAGCTATCTTCTGTGCATCTCTGAAAATAAGGAAAATGTTAGGGACAAAAAAAAGGGCAACATTTTTATTGGCATTGTGGTAAGTACTTTGCAGGTGAGGAACAAATGTTAGATGTTCATGGTATCTCTAAATATGATCTATCATGTATGGTTTATAATAAGGATATCTGATGAAGTGTACCTTCAGATAATTATACAAGAAAA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 8 seqb mnr_start 151 seqb mnr_end 158.

$sequence: ATTTAGCATATAATTATTTTTCTTTAATTATTATTAAATGTGAATCCCCTAATCAAGCTGGATGATGCTGTAAATGTTGATGAGATAATGACTGATACTTCTACCAGCTATCTTCTGTGCATCTCTGAAAATAAGGAAAATGTTAGGGACAAAAAAAAGGGCAACATTTTTATTGGCATTGTGGTAAGTACTTTGCAGGTGAGGAACAAATGTTAGATGTTCATGGTATCTCTAAATATGATCTATCATGTATGGTTTATAATAAGGATATCTGATGAAGTGTACCTTCAGATAATTATACAAGAAAA.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 8 seqb mnr_start 151 seqb mnr_end 158 seqa tract_start 1 seqa tract_end 5 seqb tract_start 17 seqb tract_end 21 seqa tract_start 1 seqa tract_end 4 seqb tract_start 46 seqb tract_end 49 seqa tract_start 1 seqa tract_end 4 seqb tract_start 128 seqb tract_end 131 seqa tract_start 1 seqa tract_end 4 seqb tract_start 137 seqb tract_end 140 seqa tract_start 1 seqa tract_end 8 seqb tract_start 151 seqb tract_end 158 seqa tract_start 1 seqa tract_end 5 seqb tract_start 167 seqb tract_end 171 seqa tract_start 1 seqa tract_end 4 seqb tract_start 305 seqb tract_end 308.

highlight_homology: seqb mnr_start 151 seqb mnr_end 158 seqb tract_start 17 seqb tract_end 21 seqb tract_start 46 seqb tract_end 49 seqb tract_start 128 seqb tract_end 131 seqb tract_start 137 seqb tract_end 140 seqb tract_start 151 seqb tract_end 158 seqb tract_start 167 seqb tract_end 171 seqb tract_start 305 seqb tract_end 308.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '5' AND position = 79970915 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '5' AND position = 79970915 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '5' AND position = 79970915 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '5' AND position = 79970915;