SelTarbase logo
? HELP ?

MNR_ensembl, genomic target for ENSG00000065978@66_37.C8.43148274 ()

MNR C8 at position 43148274 on chromosome 1.

BLAST

flanking sequence: 150bp 300bp 600bp 1200bp each.
GCGGACCCCA GAGAGCCCTG AGCAGCCCCA CCGCCGCCGC CGGCCTAGTT ACCATCACAC CCCGGGAGGA GCCGCAGCTG CCGCAGCCGG CCCCAGTCAC CATCACCGCA ACCATGAGCA GCGAGGCCGA GACCCAGCAG CCGCCCGCCG CCCCCCCCGC CGCCCCCGCC CTCAGCGCCG CCGACACCAA GCCCGGCACT ACGGGCAGCG GCGCAGGGAG CGGTGGCCCG GGCGGCCTCA CATCGGCGGC GCCTGCCGGC GGGGACAAGA AGGTCATCGG TGAGGACCGG ACAGGGACGG GGGTGGGG
sequence fetched by ensembl-0.2, a tool for quick access to parts of large fasta sequences (written by Thomas Woerner).

SelTarbase: MNR_ensembl 66_37, human.


/data/MNR_ensembl/ensembl-0.2/ensembl -p -fa /data/ensembl/human_66_37/1.fa 308 43148124

sequence GCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAGCTGCCGCAGCCGGCCCCAGTCACCATCACCGCAACCATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCCCCGCCGCCCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGGAGCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGGTGAGGACCGGACAGGGACGGGGGTGGGG, GCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAGCTGCCGCAGCCGGCCCCAGTCACCATCACCGCAACCATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCCCCGCCGCCCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGGAGCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGGTGAGGACCGGACAGGGACGGGGGTGGGG.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 8 seqb mnr_start 151 seqb mnr_end 158.

$sequence: GCGGACCCCAGAGAGCCCTGAGCAGCCCCACCGCCGCCGCCGGCCTAGTTACCATCACACCCCGGGAGGAGCCGCAGCTGCCGCAGCCGGCCCCAGTCACCATCACCGCAACCATGAGCAGCGAGGCCGAGACCCAGCAGCCGCCCGCCGCCCCCCCCGCCGCCCCCGCCCTCAGCGCCGCCGACACCAAGCCCGGCACTACGGGCAGCGGCGCAGGGAGCGGTGGCCCGGGCGGCCTCACATCGGCGGCGCCTGCCGGCGGGGACAAGAAGGTCATCGGTGAGGACCGGACAGGGACGGGGGTGGGG.

HIGHLIGHT:
seqa mnr_start 1 seqa mnr_end 8 seqb mnr_start 151 seqb mnr_end 158 seqa tract_start 1 seqa tract_end 4 seqb tract_start 6 seqb tract_end 9 seqa tract_start 1 seqa tract_end 4 seqb tract_start 26 seqb tract_end 29 seqa tract_start 1 seqa tract_end 4 seqb tract_start 60 seqb tract_end 63 seqa tract_start 1 seqa tract_end 4 seqb tract_start 91 seqb tract_end 94 seqa tract_start 1 seqa tract_end 8 seqb tract_start 151 seqb tract_end 158 seqa tract_start 1 seqa tract_end 5 seqb tract_start 163 seqb tract_end 167 seqa tract_start 1 seqa tract_end 4 seqb tract_start 261 seqb tract_end 264 seqa tract_start 1 seqa tract_end 5 seqb tract_start 299 seqb tract_end 303 seqa tract_start 1 seqa tract_end 4 seqb tract_start 305 seqb tract_end 308.

highlight_homology: seqb mnr_start 151 seqb mnr_end 158 seqb tract_start 6 seqb tract_end 9 seqb tract_start 26 seqb tract_end 29 seqb tract_start 60 seqb tract_end 63 seqb tract_start 91 seqb tract_end 94 seqb tract_start 151 seqb tract_end 158 seqb tract_start 163 seqb tract_end 167 seqb tract_start 261 seqb tract_end 264 seqb tract_start 299 seqb tract_end 303 seqb tract_start 305 seqb tract_end 308.

mysql:
SELECT ENSG, hugoID, line, lineG, 'cMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_cMNRs_66_37 jC LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jC.lineG = jE.line) WHERE chromosome = '1' AND position = 43148274 UNION SELECT ENSG, hugoID, line, lineG, 'uMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_uMNRs_66_37 jU LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jU.lineG = jE.line) WHERE chromosome = '1' AND position = 43148274 UNION SELECT ENSG, hugoID, line, lineG, 'ncrMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_ncrMNRs_66_37 jR LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jR.lineG = jE.line) WHERE chromosome = '1' AND position = 43148274 UNION SELECT ENSG, hugoID, line, lineG, 'iMNR', nucleotide, length, position, chromosome, strand FROM MNR_ensembl.human_iMNRs_66_37 jI LEFT JOIN MNR_ensembl.species_cMNRs_66_37 jE ON (jI.lineG = jE.line) WHERE chromosome = '1' AND position = 43148274;