previous  nextX95654.A10.2986 (SYCP1) -> ENSG00000198765@66_37.A10.115537601
         ? HELP ?
Tract / statusA10 / cMNR -> Tx!   MNR_ensembl
First published bySCHWARTZS1999 PubMed
Accession numberX95654 gi:1212982
Gene (chromosome)SYCP1  ( 1 )   SOURCE
alt. namesSYCP1;SCP1PRT
EnsemblENSG00000198765   SMART   GermOnline   GeneCards
NCBIEntrez Gene 6847   Unigene Hs.112743 (SAGE)   GeneCards 6847 

Mutation rate [%] Colon Endometrium Stomach Urothel
Cancer Adenoma Culture Cancer Cancer Cancer
20.052.90.026.7
(n=60)(n=17)(n=30)(n=15)

Genomic sequence
BLAST WWW
BLAST local
GCACTTAAAA AATTAAACAT GTTATGATTT TTAAATTTTA TTTTGTACTC AGGCCCCTTC ATCTCTAACA ACCCCTGGAT CTACACTGAA GTTTGGAGCT ATAAGAAAAA TGCGGGAGGA CCGTTGGGCT GTAATTGCTA AAATGGATAG AAAAAAAAAA CTAAAAGAAG CTGAAAAGTT ATTTGTTTAA TTTCAGAGAA TCAGTGTAGT TAAGGAGCCT AATAACGTGA AACTTATAGT TAATATTTTG TTCTTATTTG CCAGAGCCAA ATTTTATCTG GAAGTTGAGA CTTAAAAAAT ACTTGCATGA
MNR, transcribed, primer.
PCR system1sense CCCCTTCATCTCTAACAACCC, antisense CACTgATTCTCTgAAATTAAACAAATAAC, product length 153, Ta 60.
Transcript sequenceTAGGAACAAT AATCCACCAG CTTCTCATCT TTGTGTCAAA ACACCAAAAA AGGCCCCTTC ATCTCTAACA ACCCCTGGAC CTACACTGAA GTTTGGAGCT ATAAGAAAAA TGCGGGAGGA CCGTTGGGCT GTAATTGCTA AAATGGATAG AAAAAAAAAA CTAAAAGAAG CTGAAAAGTT ATTTGTTTAA TTTCAGAGAA TCAGTGTAGT TAAGGAGCCT AATAACGTGA AACTTATAGT TAATATTTTG TTCTTATTTG CCAGAGCCAC ATTTTATCTG GAAGTTGAGA CTTAAAAAAT ACTTGCATGA
MNR, homologue to genomic MNR region.
Transcripts#ENSTtranscribedtranslatedATGSTOPlengthMNRENSPlocate
1ENST0000036952211241317235223132ENSP00000358535show
2ENST000004559870017925582554ENSP00000410011show
3ENST0000036951811174310534523065ENSP00000358531show
4ENST0000047721500579--
5ENST0000046819100396--
6ENST0000048271700763--
7ENST0000049337700783--
8ENST00000477590100800426--
9ENST000005367340021025982597ENSP00000441292show
Shown are all Ensembl transcripts (ENSTs) currently annotated for the respective Ensembl gene (ENSG), Ensembl rel. 66_37.
final status: cMNR (cMNR) .

Culture data cell line   mutated   allele(s)  reference
Co115 1 m1 WOERNER2001
Colo60H 0 wt WOERNER2001
DLD1 1 m1wt KIM2013C
HCT116 0 wt WOERNER2001
HCT8/HRT18 1 m1wt KIM2013C
KM12 0 wt WOERNER2001
LoVo 1 p1 WOERNER2001
LS174T 0 wt WOERNER2001
LS180 0 wt WOERNER2001
RKO 0 wt WOERNER2001
SNU-407 1 m1wt KIM2013C
SNU-C2A 1 m1 KIM2013C
SNU-C2B 1 m1 KIM2013C
SNU-C4 1 m1 KIM2013C
SW48 0 wt WOERNER2001
TC7 1 m1wt INTERN9999
TC71 0 wt INTERN9999

Show consequences concerning peptide sequence(s) of frameshift alleles m2/m1/p1/p2.


1 primers derived from WOERNER2001.

SelTarbase version latest, release 201307, last updated 20130701.

? HELP ?