previous  nextNT_034483@GI@22042962.A27.5371866 (MSH2) -> ENSG00000095002@66_37.A27.47641560
         ? HELP ?
Tract / statusA27, reported length 26 / iMNR   MNR_ensembl
First published byPARSONS1995B PubMed
Accession numberNT_034483 gi:22042962
Gene (chromosome)MSH2  ( 2 )   SOURCE
alt. namesBAT26
EnsemblENSG00000095002   SMART   GermOnline   GeneCards
NCBIEntrez Gene 4436   Unigene Hs.156519 (SAGE)   GeneCards 4436 

Mutation rate [%] Colon Endometrium Stomach Urothel
Cancer Adenoma Culture Cancer Cancer Cancer
92.5100.079.992.3
(n=4520)(n=48)(n=343)(n=765)

Genomic sequence
BLAST WWW
BLAST local
TGCAGTTTCA TCACTGTCTG CGGTAATCAA GTTTTTAGAA CTCTTATCAG ATGATTCCAA CTTTGGACAG TTTGAACTGA CTACTTTTGA CTTCAGCCAG TATATGAAAT TGGATATTGC AGCAGTCAGA GCCCTTAACC TTTTTCAGGT AAAAAAAAAA AAAAAAAAAA AAAAAAAGGG TTAAAAATGT TGAATGGTTA AAAAATGTTT TCATTGACAT ATACTGAAGA AGCTTATAAA GGAGCTAAAA TATTTTGAAA TATTATTATA CTTGGATTAG ATAACTAGCT TTAAATGGCT GTATTTTTCT CTCCCCTCCT CCACTCC
MNR, transcribed, primer.
PCR systemsense TgACTACTTTTgACTTCAgCC, antisense AACCATTCAACATTTTTAACCC, product length 122, Ta 55.
Transcript sequenceTGCAGTTTCA TCACTGTCTG CGGTAATCAA GTTTTTAGAA CTCTTATCAG ATGATTCCAA CTTTGGACAG TTTGAACTGA CTACTTTTGA CTTCAGCCAG TATATGAAAT TGGATATTGC AGCAGTCAGA GCCCTTAACC TTTTTCAGGG TTCTGTTGAA GATACCACTG GCTCTCAGTC TCTGGCTGCC TTGCTGAATA AGTGTAAAAC CCCTCAAGGA CAAAGACTTG TTAACCAGTG GATTAAGCAG CCTCTCATGG ATAAGAACAG AATAGAGGAG AGATTGAATT TAGTGGAAGC TTTTGTAGAA GATGCAGAAT TGAGGCA
MNR, homologue to genomic MNR region.
Transcripts#ENSTtranscribedtranslatedATGSTOPlengthMNRENSPlocate
1ENST000002331460022430293307ENSP00000233146show
2ENST0000045484900140563560ENSP00000411482show
3ENST00000406134006328293628ENSP00000384199show
4ENST0000046139400416--
5ENST0000046732300313--
6ENST00000419559004124742918ENSP00000391195show
7ENST00000432737004116432917ENSP00000395752show
8ENST00000453755004114992917ENSP00000390362show
9ENST00000448533004112742918ENSP00000415023show
10ENST00000394792004110672917ENSP00000378272show
11ENST000005435550014027473018ENSP00000442697show
12ENST000004138800010322662537ENSP00000402969show
13ENST000004228100067811851184ENSP00000389452show
Shown are all Ensembl transcripts (ENSTs) currently annotated for the respective Ensembl gene (ENSG), Ensembl rel. 66_37.
final status: unclear (iMNR) .

Culture data cell line   mutated   allele(s)  reference
C1a 1 - DENG2006
Co115 1 m_103* HOANG1997 / *INTERN9999
COGA1 1 - VECSEYSEMJEN2002
Colo60H 1 m_98_104_108 INTERN9999
CW2 1 - CGP_SANGER
DLD1 1 m_105_113* KU1999 / *INTERN9999
Gp2D 1 m_104* CGP_SANGER / *INTERN9999
GP5d 1 - CGP_SANGER
HCT C 1 - DENG2006
HCT116 1 m_106* HOANG1997 / *INTERN9999
HCT15 1 - HOANG1997
HCT8/HRT18 1 m_113* KU1999 / *INTERN9999
HDC108 1 m_106 INTERN9999
HDC143 1 m_109 INTERN9999
HDC9 1 m_105 INTERN9999
KM12 1 m_105* CGP_SANGER / *INTERN9999
LIM1215 1 m_106_ INTERN9999
LoVo 1 m_delMSH2* KOH2005 / *HOANG1997
LS174T 1 m_106* HOANG1997 / *INTERN9999
LS180 1 m_106 INTERN9999
LS411 1 m_106* VINCENT1997 / *INTERN9999
LS411N 1 - CGP_SANGER
NCIH630 1 - CGP_SANGER
RKO 1 m_106* VINCENT1997 / *INTERN9999
SNU-1040 1 - KU1999
SNU-1047 1 - KU1999
SNU-1544 1 m KU2010A
SNU-1684 1 m KU2010A
SNU-1746 1 m KU2010A
SNU-175 1 - KU1999
SNU-407 1 - KU1999
SNU-769A 1 - KU1999
SNU-769B 1 - KU1999
SNU-C2A 1 - KU1999
SNU-C2B 1 - CGP_SANGER
SNU-C4 1 - KU1999
SW48 1 m_105_108* VINCENT1997 / *INTERN9999
TC7 1 m_105 INTERN9999
TC71 1 m_108* HOANG1997 / *INTERN9999
VaCo432 1 m_107 INTERN9999
VaCo457 1 m_105_108 INTERN9999
VaCo5 1 m_106_110* DENG2006 / *INTERN9999
VaCo6 1 m_109* DENG2006 / *INTERN9999
VaCo670 1 - BERG2000

SelTarbase version latest, release 201307, last updated 20130701.

? HELP ?