previous  nextAF027302.A10.312 (ABCF1) -> ENSG00000204574@66_37.A10.30545854
         ? HELP ?
Tract / statusA10 / cMNR -> Tx!   MNR_ensembl
First published byKIM2002A PubMed
Accession numberAF027302 gi:2522533
Gene (chromosome)ABCF1  ( 6 )   SOURCE
alt. namesTSAP
EnsemblENSG00000204574   SMART   GermOnline   GeneCards
NCBIEntrez Gene 23   Unigene Hs.655285 (SAGE)   GeneCards 23 

Mutation rate [%] Colon Endometrium Stomach Urothel
Cancer Adenoma Culture Cancer Cancer Cancer
29.366.716.733.3
(n=58)(n=15)(n=12)(n=15)

Genomic sequence
BLAST WWW
BLAST local
AGGGCCCACC AATCCTGGGA GGCATCTGGG TTCCACCAAC CCCTTTCCAG CCCATGTTGC TCCATTCAGC TGATGGGGAA CCCTCTGTGA GGCAGAAATA CAGCAGGGGC CTGGGCTTCA TTTTCTCACT GTTCTTTTGC TCTCAGCAGC AAAAAAAAAA GCGAGATACC CGAAAAGGCA GGCGGAAGAA GGATGTGGAT GATGATGGAG AAGAGAAAGA GCTCATGGAG CGTCTTAAGA AGCTCTCAGT GCCAACCAGT GATGAGGAGG ATGAAGGTAA ATGACCTGAG GGGGAATGGG TACCTGGAAT
MNR, transcribed, primer.
PCR systemsense ggCAgAAATACAgCAgggg, antisense CATCATCCACATCCTTCTTCC, product length 114, Ta 58.
Transcript sequenceCATCAGACAA AGTGGTGAAG AAAGGGAAGA AGGACAAGAA GATCAAAAAA ACGTTCTTTG AAGAGCTGGC AGTAGAAGAT AAACAGGCTG GGGAAGAAGA GAAAGTGCTC AAGGAGAAGG AGCAGCAGCA GCAGCAACAG CAACAGCAGC AAAAAAAAAA GCGAGATACC CGAAAAGGCA GGCGGAAGAA GGATGTGGAT GATGATGGAG AAGAGAAAGA GCTCATGGAG CGTCTTAAGA AGCTCTCAGT GCCAACCAGT GATGAGGAGG ATGAAGTACC CGCCCCAAAA CCCCGCGGAG GGAAGAAAAC
MNR, homologue to genomic MNR region.
Transcripts#ENSTtranscribedtranslatedATGSTOPlengthMNRENSPlocate
1ENST000003261951111326513481330ENSP00000313603show
2ENST00000376545119625203131313ENSP00000365728show
3ENST00000441867115610791074276ENSP00000405512show
4ENST0000046895810291609606217ENSP00000440893show
5ENST0000039651511377541483254ENSP00000379772show
6ENST0000054277200223--
7ENST0000047599300217932860ENSP00000445100show
8ENST0000047954200893--
9ENST00000455943119616982526316ENSP00000398294show
Shown are all Ensembl transcripts (ENSTs) currently annotated for the respective Ensembl gene (ENSG), Ensembl rel. 66_37.
final status: cMNR (cMNR) .

Culture data cell line   mutated   allele(s)  reference
Co115 1 m2m1wt WOERNER2010
Colo60H 1 m1wt WOERNER2010
DLD1 0 wt YOU2007
HCT116 1 m2wt YOU2007
HCT8/HRT18 0 wt YOU2007
KM12 0 wt WOERNER2010
LOVO 1 m1wt YOU2007
LS174T 1 m1wt YOU2007
LS180 1 m1wt WOERNER2010
RKO 1 m1wt WOERNER2010
SNU-C2A 0 wt YOU2007
SNU-C4 1 m1wt YOU2007
SW48 1 m1wt WOERNER2010
TC7 1 m1wt WOERNER2010
TC71 0 wt WOERNER2010

Show consequences concerning peptide sequence(s) of frameshift alleles m2/m1/p1/p2.


SelTarbase version latest, release 201307, last updated 20130701.

? HELP ?